View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9337_low_28 (Length: 298)
Name: NF9337_low_28
Description: NF9337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9337_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 288
Target Start/End: Complemental strand, 18012470 - 18012203
Alignment:
| Q |
20 |
tgacgcatgttgttgtgtgtacgacatatgttagtgtccaaaatcaacacgacattagggcatgtatgcgctttatagggtgtgattatatactttccat |
119 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
18012470 |
tgacacatgatgttgtgtgtacgacatatgttagtgtccaaaatcaacacgacattagggcatgtatgcgctttataggttgtgat-atatactttccat |
18012372 |
T |
 |
| Q |
120 |
ttctacttgttgaatgtcaannnnnnnnnnnnnnnnacattgtagatgaaattccacgaacttctgatgcttttggggctgataatcatagtatggcagt |
219 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18012371 |
ttctacttgttgaatgtcaattttttctttttctttacattgtagatgaaattccacgaacttctgatgcttctggggctgataatcatagtatggcagt |
18012272 |
T |
 |
| Q |
220 |
agatttcaagccagatacaactttatcaaatgtaagtaaaaatattttggtttctttcgattctctctg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18012271 |
agatttcaagccagatacaactttatcaaatgtaagtaaaaatattttggtttctttcgattctttctg |
18012203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University