View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9337_low_37 (Length: 277)
Name: NF9337_low_37
Description: NF9337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9337_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 43953343 - 43953583
Alignment:
| Q |
20 |
tgcacatgttgaaaccttgattaagttaagcattggtgagttcattgtctacaaaatcataatagctggaagaagcgaacttttcaaggttccaagggaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953343 |
tgcacatgttgaaaccttgattaagttaagcattggtgagttcattgtctacaaaatcataatagctggaagaagcgaacttttcaaggttccaagggaa |
43953442 |
T |
|
| Q |
120 |
taaatcgttagatggacgaaacttgaaagggtgttcgtatgagtatcataaatcagaggagaggctagctagtgtaataattcattcaaaaatat--tga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
43953443 |
taaatcgttagatggacgaaacttgaaagggtgttcgtatgagtatcataaatcagaggagaggctagctagtg---taattcattcaaaaatattgtga |
43953539 |
T |
|
| Q |
218 |
gttaacatgaattgatcactaataaaatcatcatccctgagaag |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953540 |
gttaacatgaattgatcactaataaaatcatcatccctgagaag |
43953583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University