View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9337_low_47 (Length: 251)
Name: NF9337_low_47
Description: NF9337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9337_low_47 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 251
Target Start/End: Original strand, 43952830 - 43953072
Alignment:
| Q |
9 |
aagcagagataagtttatataggaatcaacctccaatataatataaatattcnnnnnnngttggcattatcaatatatattctttattcgttactcttgg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952830 |
aagcagagataagtttatataggaatcaacctccaatataatataaatattctttttttgttggcattatcaatatatattctttattcgttactcttgg |
43952929 |
T |
 |
| Q |
109 |
agcataagaagcatataacttttactattacttattgtctttgcagaggaaagaatgtaacacaacacagcttcaacagtcactgaagtgggtataaaaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952930 |
agcataagaagcatataacttttactattacttattgtctttgcagaggaaagaatgtaacacaacacagcttcaacagtcactgaagtgggtataaaaa |
43953029 |
T |
 |
| Q |
209 |
agaatcaagatgatagaaaaaagtatggacaaaaagaacagaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953030 |
agaatcaagatgatagaaaaaagtatggacaaaaagaacagaa |
43953072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University