View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9337_low_49 (Length: 248)
Name: NF9337_low_49
Description: NF9337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9337_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 232
Target Start/End: Original strand, 32688397 - 32688610
Alignment:
| Q |
18 |
aatacttcaatatgtgaagaagggaacttccaacattggaattatatatcctaaaaatgcagaagtttgcttgctatattcagattggtggtggtcatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32688397 |
aatacttcaatatgtgaagaagggaacttccaacattggaattatatatcctaaaaatgcagaagtttgcttgctatattcagattggtg-tggtcatga |
32688495 |
T |
 |
| Q |
118 |
aagtaatagcaaaacacagtagataatgcttttgtgtgtgggaaaatcctctgggcatcggacaaatagtttatggcagtggccaaatgtaaagtgaggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32688496 |
aagtaatagcaaaacacagtagataatgcttttgtgtgtgggaaaatcctctgggcatcggacaaatagtttatggtggtggccaaatgtaaagtgaggt |
32688595 |
T |
 |
| Q |
218 |
cgagcatgttgttac |
232 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32688596 |
cgagcatgttgttac |
32688610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University