View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9338_low_4 (Length: 343)
Name: NF9338_low_4
Description: NF9338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9338_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 17 - 338
Target Start/End: Complemental strand, 52730352 - 52730032
Alignment:
| Q |
17 |
aaaaagtgtgtaacattgtcgattaaattatttagaaaaacatatcgtaatatgtttgttgggaatgaaattattgttagtgttgacttaatcaaaatat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52730352 |
aaaaagtgtgtaacattgtcgattaaattatttagaaaaacatatagtaatatgtttgttgggaatgaaattattgttagtgttgacttaatcaaaatat |
52730253 |
T |
 |
| Q |
117 |
taagcggtgaacatgggcacgcaaacccaaagtatacggttcttgtactttgtatgacacatcacatacacaacacaacaagtggcccttccacttctct |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52730252 |
taagcggtgaacatgggcacgcaaccccaaagtatacggttcttgtactttgtatgacacatcacatacacaacacaacaagtggcccttccacttctct |
52730153 |
T |
 |
| Q |
217 |
catccgtacacttctttcactttgtctctataaaactaaacaaactctctttcttttctctcatccatcgatccatatatcccctaatttctttctg--- |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52730152 |
catccgtacacttctttcactttgtctctataaaactaaacaaactctctttcttttctctcatccatcgatcc----atcccctaatttctttctgatc |
52730057 |
T |
 |
| Q |
314 |
atcatcatcaatctcctttgcttct |
338 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52730056 |
atcatcatcaatctcctttgcttct |
52730032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University