View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9339_low_10 (Length: 242)

Name: NF9339_low_10
Description: NF9339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9339_low_10
NF9339_low_10
[»] chr2 (3 HSPs)
chr2 (10-226)||(3895268-3895484)
chr2 (13-71)||(3895139-3895197)
chr2 (10-73)||(3895016-3895079)


Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 3895268 - 3895484
Alignment:
10 gcagagagtgctggggagaaagctagagattatgcttatgatgcaaaggaaagaaccaaggaaggagcgagttacatggctgataagacaaaagaaggag 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3895268 gcagagagtgctggggagaaagctagagattatgcttatgatgcaaaggaaagaaccaaggaaggagcgagttacatggctgataagacaaaagaaggag 3895367  T
110 ctgagaaaacggcagagaagacgggggaggttgctgggtcggcgacagaggctttgaagagtgctggggaaatggcgaagaagacggcccaaggagcgtg 209  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3895368 ctgagaaaacggcggagaagacgggggaggttgctgggtcggcgacagaggctttgaagagtgctggggaaatggcgaagaagacggcccaaggagcgtg 3895467  T
210 ggagacagcgaaggatg 226  Q
    |||||||||||||||||    
3895468 ggagacagcgaaggatg 3895484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 13 - 71
Target Start/End: Original strand, 3895139 - 3895197
Alignment:
13 gagagtgctggggagaaagctagagattatgcttatgatgcaaaggaaagaaccaagga 71  Q
    |||| |||||| ||||| ||||||||||||||||||||||||||||| ||||| |||||    
3895139 gagaatgctggagagaaggctagagattatgcttatgatgcaaaggagagaacaaagga 3895197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 3895016 - 3895079
Alignment:
10 gcagagagtgctggggagaaagctagagattatgcttatgatgcaaaggaaagaaccaaggaag 73  Q
    ||||||| |||||| |||||||||||||| ||||||||||| | ||| || |||||||| ||||    
3895016 gcagagaatgctggagagaaagctagagactatgcttatgaggtaaaagacagaaccaatgaag 3895079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University