View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9339_low_5 (Length: 274)
Name: NF9339_low_5
Description: NF9339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9339_low_5 |
 | |
|
| [»] scaffold0028 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0028 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 123630 - 123886
Alignment:
| Q |
1 |
cattggtctcatggttttcagaacagaatagcggtaaggtatcaccctttgcagccc-tgttgcacttagagcatgctttgtagtaccacccattcttgg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
123630 |
cattggtctcatggttttcagaacagaatagcggtaaggtatcaccctttgcagcccctgttgcacttagtgcacgctttgtagtaccacccattcttgg |
123729 |
T |
|
| Q |
100 |
atggtttgacttgattaatcttcacaacagtcacacacaaagttgtctgtgggagaaaataaaaagacacaccatgatatgtattagttaatttatagat |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123730 |
atggtttgacttgattaa-cttcacaacaatcacacacaaagttgtctgtgggagaaaataaaaagacacaccatgatatgtattagttaatttatagat |
123828 |
T |
|
| Q |
200 |
catattatnnnnnnnggaaaataataatgagttgagaattaggtatctaataaggaag |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123829 |
catattataaaaaaaggaaaataataatgagttgagaattaggtatctaataaggaag |
123886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 33 - 147
Target Start/End: Original strand, 22078464 - 22078578
Alignment:
| Q |
33 |
ggtaaggtatcaccctttgcagccctgttgcacttagagcatgctttgtagtaccacccattcttggatggtttgacttgattaatcttcacaacagtca |
132 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||||| | |||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
22078464 |
ggtaaagtatcaccctttgcaactctgttgcacttggtgcatgctttgtagtaccacccattcttggatggtttcacttgattgatcttcacaacagtca |
22078563 |
T |
|
| Q |
133 |
cacacaaagttgtct |
147 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
22078564 |
cacacacagttgtct |
22078578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 33 - 147
Target Start/End: Original strand, 23697468 - 23697582
Alignment:
| Q |
33 |
ggtaaggtatcaccctttgcagccctgttgcacttagagcatgctttgtagtaccacccattcttggatggtttgacttgattaatcttcacaacagtca |
132 |
Q |
| |
|
||||| |||||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||| || || | |||| ||| |
|
|
| T |
23697468 |
ggtaaagtatcaccctttgcagccctgttgcatttggtgcatgctttgtagtaccacccattcttggatggtttgacttgattgattttaagaacaatca |
23697567 |
T |
|
| Q |
133 |
cacacaaagttgtct |
147 |
Q |
| |
|
|||||| |||||||| |
|
|
| T |
23697568 |
cacacacagttgtct |
23697582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University