View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9340_low_13 (Length: 207)

Name: NF9340_low_13
Description: NF9340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9340_low_13
NF9340_low_13
[»] chr1 (2 HSPs)
chr1 (108-191)||(38210064-38210147)
chr1 (35-82)||(38210019-38210066)


Alignment Details
Target: chr1 (Bit Score: 72; Significance: 6e-33; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 108 - 191
Target Start/End: Original strand, 38210064 - 38210147
Alignment:
108 atctacaattgttcataacaacaattctaaacgttgtgaaattgtttagaattgcacttatctaaaaactccattgtttctgtg 191  Q
    ||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
38210064 atctacaattgttctaaacaacaattctaaacgttgtgaaattgtttagaattgcacttatctaaaaactccattgtttttgtg 38210147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 35 - 82
Target Start/End: Original strand, 38210019 - 38210066
Alignment:
35 actaaaactccgatcaagatcccatgtaacaaccgcacacggtacatc 82  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||    
38210019 actaaaactccgatcaggatcccatgtaacaaccgcacacggtacatc 38210066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University