View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9341_high_5 (Length: 332)
Name: NF9341_high_5
Description: NF9341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9341_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 21481839 - 21481663
Alignment:
| Q |
17 |
cttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagtta---gaaggtgggtta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
21481839 |
cttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagttagaagaaggtgggtta |
21481740 |
T |
|
| Q |
114 |
ataaaaacaagttgtctctaaccnnnnnnnngcattgattcatgattagg-aaaaaacaagaattgccaaacagtgg |
189 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
21481739 |
ataaaaacaagttgtctctaaacttttttttgcattgattcatgattgggaaaaaaacaagaattgccaaacagtgg |
21481663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 11 - 189
Target Start/End: Complemental strand, 26661926 - 26661746
Alignment:
| Q |
11 |
cacagacttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgtcatggttattagcatattttgggaaaagtta---gaaggt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
26661926 |
cacaggcttattggttattactagcacatgctgaagttttacgaacaaagaattcagcgttatggttattagcatattttggaaaaagttagaagaaggt |
26661827 |
T |
|
| Q |
108 |
gggttaataaaaacaagttgtctctaaccnnnnnnnngcattgattcatgattaggaaaaaacaagaattgccaaacagtgg |
189 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26661826 |
ggtttaataaaaacaagttgtctctaacctttttttt-cattgattcatgattgggaaaaaacaagaattgccaaacagtgg |
26661746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University