View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9341_low_13 (Length: 319)
Name: NF9341_low_13
Description: NF9341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9341_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 11559660 - 11559930
Alignment:
| Q |
1 |
ttagactcggattgattgaccataaatgggtgttgagacttgtttttgttgggtcaactcggtgggtggtgggtggaccggtttccgtgttggtggtctc |
100 |
Q |
| |
|
|||||||| ||||||||||||| |||||| || |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11559660 |
ttagactcagattgattgaccagaaatggttgctgagacttgtttttgttgggtcaactcggtggatggtgggtggaccggtttccgtgttggtggtctc |
11559759 |
T |
|
| Q |
101 |
gtttactcaccgttatcacaatctctattcgttgcatttcaacacacacttcatannnnnnngtaatatggtttcagatccgtaatcaggtatgcttgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11559760 |
gtttactcaccgttatcacaatctctattcgttgcatttcagcacacacttcatatttttttgtaatatggtttcagatccgtaatcaggtatgcttgat |
11559859 |
T |
|
| Q |
201 |
tatgcatgtggtgtgtgattgtttgttatgaagttggatttgagctctctattgttttatttgcccatttg |
271 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
11559860 |
tatgcatttggtgtgtgattgtttgttatgaacttggatttaagctctctattgttttatttacccatttg |
11559930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 9508284 - 9508424
Alignment:
| Q |
1 |
ttagactcggattgattgaccataaatgggtgttgagacttgtttttgttgggtcaactcggtgggtggtgggtggaccggtttccgtgttggtggtctc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||| |||||||||| |||| |||||||||||| |||| |||||||||| || ||||| |
|
|
| T |
9508284 |
ttagactcggattgattgaccataaatggttgttgagagttgttgttgttgggtctactcaatgggtggtgggttgacccgtttccgtgtcggcggtctt |
9508383 |
T |
|
| Q |
101 |
gtttactcaccgttatcacaatctctattcgttgcatttca |
141 |
Q |
| |
|
||| |||||| ||||||| ||| | ||| ||||||||||| |
|
|
| T |
9508384 |
gttcactcactgttatcataatatgcatttgttgcatttca |
9508424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 262
Target Start/End: Complemental strand, 1773631 - 1773562
Alignment:
| Q |
193 |
tgcttgattatgcatgtggtgtgtgattgtttgttatgaagttggatttgagctctctattgttttattt |
262 |
Q |
| |
|
|||| |||| |||||| |||||||| |||||||||| | |||||| |||||| ||||||||||||||| |
|
|
| T |
1773631 |
tgctagattgtgcatgcggtgtgtggatgtttgttatagacttggatctgagctttctattgttttattt |
1773562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 25657336 - 25657077
Alignment:
| Q |
1 |
ttagactcggattgattgaccataaatgggtgttgagacttgtttttgttgggtcaactcggtgggtggtgggtggaccggtttccgtgttggtggtctc |
100 |
Q |
| |
|
|||||||| |||| |||||||||||||| ||| |||| | ||| ||||||||| |||| ||||||| |||||||||| |||| |||||||| | || |
|
|
| T |
25657336 |
ttagactcaaattgtttgaccataaatggttgtggagagtagttgatgttgggtcgactcagtgggtgctgggtggacccgttttcgtgttggcgatcgg |
25657237 |
T |
|
| Q |
101 |
gtttactcaccgttatcacaatctctattcgttgcatttcaacacacacttcatannnnnnngtaatatggtttcagatccgtaatcaggtatgcttgat |
200 |
Q |
| |
|
||| ||| |||||||||| ||| | |||||||| ||||| ||| | || | | ||| ||||||| ||||||||||| ||| |||| ||| |
|
|
| T |
25657236 |
gttcactaaccgttatcaaaattcatggtcgttgcaactcaactcactcatcgtctttttttgcaatttggtttcggatccgtaatcgggtctgctagat |
25657137 |
T |
|
| Q |
201 |
tatgcatgtggtgtgtgattgtttgttatgaagttggatttgagctctctattgttttat |
260 |
Q |
| |
|
||||| ||||||||||| ||||||| ||| | || ||| |||||| | ||||||||||| |
|
|
| T |
25657136 |
tatgcttgtggtgtgtggttgtttgctatagacttagatatgagctttttattgttttat |
25657077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University