View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9341_low_25 (Length: 229)
Name: NF9341_low_25
Description: NF9341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9341_low_25 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 136 - 229
Target Start/End: Complemental strand, 39678326 - 39678233
Alignment:
| Q |
136 |
tttataatattgtttcgatcatattagaatatcttatttaattttctaggatctgtgtaagtattgtggatattctcttaggattagttttact |
229 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678326 |
tttataatattatttcgatcatattagaatatcttatttaattttctaggatctgtgtaagtattgtggatattctcttaggattagttttact |
39678233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 6 - 76
Target Start/End: Complemental strand, 39678531 - 39678461
Alignment:
| Q |
6 |
attctcaaggtgtatagaggaccttcagataaccacggtgtgctgcagaaatcgaatcaaatccctatttg |
76 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678531 |
attctcaaggtgtatagaggaccttcagataaccacggtgtgctgcagaaatcgaatcaaatccctatttg |
39678461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University