View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_high_14 (Length: 239)
Name: NF9344_high_14
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 32574240 - 32574435
Alignment:
| Q |
1 |
ttcagttccaccaaacaccagaaaagaaaaactttacaaaatgtataattcaatctcgcaatattccaaataggaaatggatgttaacaatgtttttctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32574240 |
ttcagttccaccaaacaccagaaaagaaaaactttacaaaatgtataattcaatcttgcaatattccaaataggaaatggatgttaacaatgtttttctt |
32574339 |
T |
 |
| Q |
101 |
aatgacacg-------nnnnnnnnngttaaccattcggtttttaacgacgcgctatgagaaaatttacgtatcccagccactagatttttcttcat |
189 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32574340 |
aatgacacgtttttttttttttttggttaaccattcggtttttaacgatgcgctatgagaaaatttacgtatcccagccactagatttttcttcat |
32574435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University