View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_high_17 (Length: 226)
Name: NF9344_high_17
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 39 - 211
Target Start/End: Original strand, 21880550 - 21880722
Alignment:
| Q |
39 |
tgtgtactatttgctaagacttaaacatgcaggcttgtgagcctcaaagtgcaatcccaaggggaagccttattaggatggaaactagagcatactcaaa |
138 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21880550 |
tgtgtactatttactaagacttgaacatgcaggcttgtgagcctcaaagtgcaatcccaaggggaagccttatgaggatggaaactagagcatactcaaa |
21880649 |
T |
 |
| Q |
139 |
atcaagtattgacaattcaaaaccaaggtgaataaaaattattggtacttatttttccataatgttatgatgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
21880650 |
atcaagtattgacaattcaaaaccaaggtgaataaaaactcttggtacttatttttccataatgttatgatgt |
21880722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University