View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_low_19 (Length: 398)
Name: NF9344_low_19
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 27 - 385
Target Start/End: Original strand, 22860761 - 22861122
Alignment:
| Q |
27 |
cgctttgttagacttattcgcattctttctctagttttta--ggtatttttccaatatttcttcttaggtttcacggattcatttcagtatcccttatta |
124 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||| ||| ||||| ||| |||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
22860761 |
cgctttgttagacttatttgcattctttctctcatttttttgggtgttttttcaaaatttcttcagaggtttcacggattcatttatgtatcccttatta |
22860860 |
T |
 |
| Q |
125 |
ggcatcaatgacttcaaa-ttttgaattttccaagagaagctaagggtatttcctttcccctttcttttaaccttagaat-cccataaagtttgagcgaa |
222 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
22860861 |
ggcatcaatgacttcaaacttttgaattttcca-gagaagctaaaggtatttcctttcccctttcttttaaccttagaaaacccataaagtttaagcgaa |
22860959 |
T |
 |
| Q |
223 |
tgttgttccagttccttatctaatagcaagggtgagatggtgagggaattcatataagaaagggatgtaggttttagctttatcgatcctaactcgatct |
322 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||| ||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22860960 |
tgttgttctagttccttatctatgaagaagggtgagagggtgagggaattcgtatcagaaagggatgtaagttttagctttatcgatcctaactcgatct |
22861059 |
T |
 |
| Q |
323 |
atttcatggagttggagaatctttgctcgctccatgttcgctatgagaaatggcacacaggtt |
385 |
Q |
| |
|
||||||||||||| | |||||||||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
22861060 |
atttcatggagtttgggaatctttgctctctccatgttcgttatgagaaatggcacataggtt |
22861122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University