View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_low_29 (Length: 290)
Name: NF9344_low_29
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 6084033 - 6084306
Alignment:
| Q |
1 |
ttgtgttactgattttaaccctgatgatgtacttgaggatattaaattggctataaagcacctgaatgatccagatcaacgcgcattagattcaggcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6084033 |
ttgtgttactgattttaaccctgatgatgtacttgaggatattaaattggctataaagcacctgaatgatccagatcaacgcgcattagattcaggcaaa |
6084132 |
T |
|
| Q |
101 |
gattattgtcaatttgatccatctaatgccgagacttcattgataaagagaactagagcacaatgtcaaaaagatctgaataaatcaataggtaaaatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6084133 |
gattattgtcaatttgatccatctaatgccgagacttcattgataaagagagctagaacacaatgtcaaaaagatctgaataaatcaataggtaaaatga |
6084232 |
T |
|
| Q |
201 |
ttgagcttattgaagggatcaacatgcctgttgacgataacgacaattcaaatcccttcatggtccgtgctttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6084233 |
ttgagcttattgaagggatcaacatgcctgttgacgataacgacaattcaaatcccttcatggtccgtgctttt |
6084306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University