View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_low_36 (Length: 237)
Name: NF9344_low_36
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_low_36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 34477617 - 34477381
Alignment:
| Q |
1 |
aaggggactcttgtttgtcttgtttcctctaatggctcattatctttatggtggttatgggtttccctataacttttctgggtatcaatgagattctccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477617 |
aaggggactcttgtttgtcttgtttcctctaatggctcattatctttatggtggttatgggtttccctataacttttctgggtatcaatgagattctcca |
34477518 |
T |
|
| Q |
101 |
ttacgttaatcccaaggaattggcggcgcaacatttaattaccatttacctctaacatggacgtagtagagagtgtcctgggtggttaagttgggagtta |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
34477517 |
ttacgttaatccgaaggaattggcggcgcaacatttgattaccatttacctctaacatggacgttgtagagagtgtcctgtgtggttgagttgggagtta |
34477418 |
T |
|
| Q |
201 |
catcttcttccagtggttctaggctatctggggccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477417 |
catcttcttccagtggttctaggctatctggggccct |
34477381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University