View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9344_low_37 (Length: 235)

Name: NF9344_low_37
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9344_low_37
NF9344_low_37
[»] chr2 (2 HSPs)
chr2 (139-220)||(4421467-4421549)
chr2 (18-106)||(4421582-4421665)
[»] chr4 (1 HSPs)
chr4 (18-51)||(38260963-38260996)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 139 - 220
Target Start/End: Complemental strand, 4421549 - 4421467
Alignment:
139 gttgcttgcgttagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgat-atctgtggttaa 220  Q
    |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4421549 gttgtttgcattagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgataatctgtggttaa 4421467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 4421665 - 4421582
Alignment:
18 agaagcgtatacatgcatatgtgagtgcttcggaaactatgattacatgcataggataggaagccaggattagccgaaatagtaatctc 106  Q
    |||||||||||||||||||||||||||||||| |||||| ||||||||||||     ||||||||||||||||||||| ||||||||||    
4421665 agaagcgtatacatgcatatgtgagtgcttcgaaaactaggattacatgcat-----aggaagccaggattagccgaactagtaatctc 4421582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 38260963 - 38260996
Alignment:
18 agaagcgtatacatgcatatgtgagtgcttcgga 51  Q
    ||||||||||||||||||||||||||| ||||||    
38260963 agaagcgtatacatgcatatgtgagtgattcgga 38260996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University