View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9344_low_38 (Length: 235)
Name: NF9344_low_38
Description: NF9344
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9344_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 139 - 220
Target Start/End: Complemental strand, 4421549 - 4421467
Alignment:
| Q |
139 |
gttgcttgcgttagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgat-atctgtggttaa |
220 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4421549 |
gttgtttgcattagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgataatctgtggttaa |
4421467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 18 - 106
Target Start/End: Complemental strand, 4421665 - 4421582
Alignment:
| Q |
18 |
agaagcgtatacatgcatatgtgagtgcttcggaaactatgattacatgcataggataggaagccaggattagccgaaatagtaatctc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
4421665 |
agaagcgtatacatgcatatgtgagtgcttcgaaaactaggattacatgcat-----aggaagccaggattagccgaactagtaatctc |
4421582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 51
Target Start/End: Original strand, 38260963 - 38260996
Alignment:
| Q |
18 |
agaagcgtatacatgcatatgtgagtgcttcgga |
51 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
38260963 |
agaagcgtatacatgcatatgtgagtgattcgga |
38260996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University