View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9345_high_4 (Length: 313)
Name: NF9345_high_4
Description: NF9345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9345_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 30654386 - 30654123
Alignment:
| Q |
1 |
gggttgcggcaaggcaatcccttgttccattatctcttcattttatgtgcagaaggcttatatgcgctcatcaaacaagctgaaagaagaggagacttgc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
30654386 |
gggtggcggcaaggcaatcccttgttccattatctcttcattttatgtgcagaaggcttatatgcgctcatcagacaagctgaaagaaggggagacttgc |
30654287 |
T |
 |
| Q |
101 |
atgacatacgaatatgtactgatgcgcctgttatatctcacctattatttgcaaatgattgtttcctttttctcatggcagaagatcgagaagctcaagt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
30654286 |
atgacatacgaatatgcactgatgcgcctgttatatctcacctattatttgcaaatgattgtttcctttttctcagggcggaagatcgagaagctcaagt |
30654187 |
T |
 |
| Q |
201 |
gatgaaaaatatattagccacatatgaagctacttttgcgcaggctattagcttacccaagttt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30654186 |
gatgaaaaatatattagccacatatgaagctacttttgcgtaggctattagcttacccaagttt |
30654123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 195 - 262
Target Start/End: Complemental strand, 14859231 - 14859164
Alignment:
| Q |
195 |
tcaagtgatgaaaaatatattagccacatatgaagctacttttgcgcaggctattagcttacccaagt |
262 |
Q |
| |
|
|||||||||||| ||||| |||| || ||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
14859231 |
tcaagtgatgaataatattttaggaacctatgaagttacttttgggtaggctattagcttacccaagt |
14859164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 98 - 165
Target Start/End: Complemental strand, 12716813 - 12716746
Alignment:
| Q |
98 |
tgcatgacatacgaatatgtactgatgcgcctgttatatctcacctattatttgcaaatgattgtttc |
165 |
Q |
| |
|
||||||||||| ||||||||| |||| || ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
12716813 |
tgcatgacatatctatatgtactaatgctcccgttatttctcaccttttatttgcagatgattgtttc |
12716746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 98 - 165
Target Start/End: Complemental strand, 12778044 - 12777977
Alignment:
| Q |
98 |
tgcatgacatacgaatatgtactgatgcgcctgttatatctcacctattatttgcaaatgattgtttc |
165 |
Q |
| |
|
||||||||||| ||||||||| |||| || ||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
12778044 |
tgcatgacatatctatatgtactaatgctcccgttatttctcaccttttatttgcagatgattgtttc |
12777977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 131 - 167
Target Start/End: Complemental strand, 48028076 - 48028040
Alignment:
| Q |
131 |
ttatatctcacctattatttgcaaatgattgtttcct |
167 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48028076 |
ttatatctcacctattatttgctgatgattgtttcct |
48028040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University