View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9346_high_2 (Length: 248)
Name: NF9346_high_2
Description: NF9346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9346_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 22419897 - 22419678
Alignment:
| Q |
16 |
gtgaatatggttcaaagaaaatttgcatactgcagtccaaggcttgtggcgaggcatgatctgaaatttgcatttaagcttgcaagagatgcaattgttt |
115 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22419897 |
gtgaatatgcttcaaagaaaatttgcatactgcagtccaaggcttgtggcgaggcatgatctgaaatttgcatttaagcttgcaagagatgcaattgttt |
22419798 |
T |
 |
| Q |
116 |
ctcaatccatgaggcctgctgaatctagcggtgtaaagagtctgaatgaaacttgtgtcatttgtttggaggatagtgatgttagtcaannnnnnncagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22419797 |
ctcaatccatgaggcctgctgaatctagcggtgtaaagagtctgaatgaaacttgtgtcatttgtttggaggatagtgatgttagtcaatttttttcagt |
22419698 |
T |
 |
| Q |
216 |
tgatggctgtcaacacaggt |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
22419697 |
tgatggctgtcaacacaggt |
22419678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University