View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9346_high_3 (Length: 217)
Name: NF9346_high_3
Description: NF9346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9346_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 13 - 199
Target Start/End: Complemental strand, 4783354 - 4783168
Alignment:
| Q |
13 |
gcatagggcacagctaattaactaacttaaactaattgatatatacacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783354 |
gcatagggcacagctaactaactaacttaaactaattgttatatgcacctaagcttgaattattaatctcaacatgctttcttaatttaaactttcaaaa |
4783255 |
T |
 |
| Q |
113 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgtttgatcattggac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4783254 |
gctacaacacctagctttcttctcagttttaaaatatggacctttttgatagacttggtgaatatatcagttgtttgatcattggac |
4783168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University