View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9348_low_14 (Length: 276)
Name: NF9348_low_14
Description: NF9348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9348_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 45 - 245
Target Start/End: Original strand, 41833872 - 41834072
Alignment:
| Q |
45 |
taaaaagcatcatgatggggtagcaaaatgtgatatagaccatggtgtacgagtgagttccaaatgcgagaatttagttatttaatggctaaagattttg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41833872 |
taaaaagcatcatgatggggtagcaaaatgtgatatagaccatggtgtacgggtgagttccaaatgcgagaatttagttatttaatggctaaagattttg |
41833971 |
T |
|
| Q |
145 |
ttatttatattcatcatgttcttcctgaagacaatgtttgtgagaattttcttgccaaaaaacaagttagtagttcaaagttgctttttgttttgcatga |
244 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41833972 |
ttatttatattcatcatgttcttcgtgaagacaatgtttgtgagaatttttttgccaaaaaagaagttagtagttcaaagttgctttttgttttgcatga |
41834071 |
T |
|
| Q |
245 |
t |
245 |
Q |
| |
|
| |
|
|
| T |
41834072 |
t |
41834072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University