View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9348_low_26 (Length: 209)
Name: NF9348_low_26
Description: NF9348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9348_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 8e-57; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 14 - 145
Target Start/End: Complemental strand, 4791865 - 4791734
Alignment:
| Q |
14 |
caaaggcattgagtggtggaattcaatgatgaagacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatg |
113 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4791865 |
caaacgcattgagtggtggacttcaatgatgaagacgaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatg |
4791766 |
T |
 |
| Q |
114 |
tgagggatcgacactctggaaaggaaccagag |
145 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| |
|
|
| T |
4791765 |
tgagggaccgacaccctggaaaggaaccagag |
4791734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 47 - 147
Target Start/End: Complemental strand, 4797368 - 4797265
Alignment:
| Q |
47 |
gacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggat---cgacactctggaaaggaaccag |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
4797368 |
gacaaggataggaataagaaataattccccgttgatgttggaagatggattgatccaatggatgatgtgagggatcgacgacactctagaaaggaaccag |
4797269 |
T |
 |
| Q |
144 |
agac |
147 |
Q |
| |
|
|||| |
|
|
| T |
4797268 |
agac |
4797265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 126
Target Start/End: Original strand, 4788530 - 4788572
Alignment:
| Q |
84 |
ttggaagatggattgatccaatggatgatgtgagggatcgaca |
126 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
4788530 |
ttggaagatgggttgatccaatggatgatgcgagggatggaca |
4788572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 192
Target Start/End: Original strand, 4788796 - 4788830
Alignment:
| Q |
158 |
tgctgtcatattcattgtgacaaatgattccatcc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
4788796 |
tgctgtcatattcattgtcacaaatgattccatcc |
4788830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 192
Target Start/End: Complemental strand, 4791529 - 4791495
Alignment:
| Q |
158 |
tgctgtcatattcattgtgacaaatgattccatcc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
4791529 |
tgctgtcatattcattgtcacaaatgattccatcc |
4791495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 192
Target Start/End: Complemental strand, 4797054 - 4797020
Alignment:
| Q |
158 |
tgctgtcatattcattgtgacaaatgattccatcc |
192 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
4797054 |
tgctgtcatattcattgtcacaaatgattccatcc |
4797020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University