View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9348_low_6 (Length: 453)
Name: NF9348_low_6
Description: NF9348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9348_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 18 - 131
Target Start/End: Original strand, 699453 - 699566
Alignment:
| Q |
18 |
ttctcagatgctaactccaaaagttagagttactttggaatatttatacctattcgtcgccattactttcttctgtattctcgttgttatgcacgctaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699453 |
ttctcagatgctaactccaaaagttagagttactttggaatatttatacctattcgtcgccattactttcttctgtattctcgttgttatgcacgctaat |
699552 |
T |
|
| Q |
118 |
tacgttcaacaggt |
131 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
699553 |
tacgttcaacaggt |
699566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 320 - 443
Target Start/End: Original strand, 700221 - 700355
Alignment:
| Q |
320 |
aaataattatcgtcttgggtttcagtgtttggcaacccaaaaatcaagatagttccactttacttcataactattcactattttctgct----------t |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
700221 |
aaataattatcgtcttgggtttcagtgtttggtaacccaaaaatcaagatagttccactttacttcataactattcactattttctgcttgattgtgaat |
700320 |
T |
|
| Q |
410 |
caacttcaattgtttttatt-caatattttctctg |
443 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
700321 |
caacttcaattgtttttattccaatattttctctg |
700355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University