View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_high_11 (Length: 265)
Name: NF9349_high_11
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 14 - 223
Target Start/End: Original strand, 40562529 - 40562735
Alignment:
| Q |
14 |
ttggtgtttaagtgggaacggtgttgatttgatatgcatgagaaatgaacggtggatttaacatttgtgacgtatgaagttgtagtaaccatattggnnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40562529 |
ttggtgtttaagtgggaacggtgttgatttgatatgcatgagaaatgaacggtggatttaacatttgtgacgtatgaagttgtagtaaccatattggaaa |
40562628 |
T |
 |
| Q |
114 |
nnnnntgaggtgaaggtgtttgaagaagagaaaggagggagaagaatgaaataagtctcaagttgagttattttgatattgatgggatccttgattatta |
213 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40562629 |
aaaaatgaggtgaagg---ttgaagaagagaaaggagggagaagaatgaaataagtctcaagttgagttattttgatattgatgggatccttgattatta |
40562725 |
T |
 |
| Q |
214 |
ttatatctat |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
40562726 |
ttatatctat |
40562735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University