View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9349_high_30 (Length: 218)

Name: NF9349_high_30
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9349_high_30
NF9349_high_30
[»] chr5 (1 HSPs)
chr5 (23-201)||(22103922-22104100)


Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 201
Target Start/End: Complemental strand, 22104100 - 22103922
Alignment:
23 tactgatcctccctcgatttgataacaccctccctcgtacacgaaaacggacgatcacgacagtgtgtcaatgaccgtccacgtccatactcatgcaaaa 122  Q
    ||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||    
22104100 tactgatcctccctcgattcgataacaccctccctcgtacccaaaaacggacgatcacgacggtgtgtcaatgaccatccacgtccatactcatgcaaaa 22104001  T
123 ccctatccctgggcaattgatcaacacgcaaattgaccctactgcgaggcctgctgtcaaacctgtcgatgccatacct 201  Q
    ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||    
22104000 ccctaaccctgggcaattgatcaacacgcaaactgaccctactgcgaggcctgctgtcaaacctgtcggtgccatacct 22103922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University