View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_31 (Length: 358)
Name: NF9349_low_31
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 13 - 358
Target Start/End: Complemental strand, 19097274 - 19096929
Alignment:
| Q |
13 |
acatcatgtgctccatcaaatatggaaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097274 |
acatcatgtgctccatcaaatatggaaactgccaatgcttacctctataaattctcatctaaaaattttaagcctcttatgatgattatgtaattgggat |
19097175 |
T |
|
| Q |
113 |
caacagaggattaccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatg |
212 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097174 |
caacagagaattaccagccggtggacccctttgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaatg |
19097075 |
T |
|
| Q |
213 |
ttattgagttgctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097074 |
ttattgagttgctgcgtcaacggagtgctgctttcattggtgacaacaggtggtgaggaagaaggggtaacctgtgtttgccgcctcggcctcccccttc |
19096975 |
T |
|
| Q |
313 |
ccctcccactaccgttcctagtcgagcttcttctagttaatcctga |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19096974 |
ccctcccactaccgttcctagtcgagcttcttctagttaatcctga |
19096929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 144 - 210
Target Start/End: Complemental strand, 32149164 - 32149098
Alignment:
| Q |
144 |
tgtcttcgaggccttcgagttgttttaccccaacctgttaggctcctatcctccaacgccacttcaa |
210 |
Q |
| |
|
||||| || ||||||| ||||| || ||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32149164 |
tgtctacggggccttcttgttgtctttccccaacctgttaggcttctatcctccaaacccacttcaa |
32149098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University