View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_40 (Length: 307)
Name: NF9349_low_40
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_40 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 16066995 - 16066719
Alignment:
| Q |
19 |
taaattcctttttgtgggaatataatctttcaattaagagcagggaataatgaagcacttgtgcgttgattgccatacatttttggtcatggccatgtca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16066995 |
taaattcctttttgtgggaatataatctttcaattaagagcagggaataatgaagcacttgtgcgttgattgccatacatttttggtcatggccatgtca |
16066896 |
T |
 |
| Q |
119 |
attgc--tatgaggatttgggttatggcttagtctgaatatgtgctggaaagtgcaatgcttttttaccagctaagaannnnnnnnnnnnnnnnnnnnnn |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16066895 |
attgctatatgaggatttgggttatggcttagtctgaatatgtgctggaaagtgcaatgcttttttaccagctaagaattttttgtttttctttattttt |
16066796 |
T |
 |
| Q |
217 |
caaaaagtttaattgtcatttaaaatggcaatgaatatgtttaatgtcaaatggctaaccatgcattctcaagtgtc |
293 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
16066795 |
caaaaactttaattgtcatttaaaatggcaatgaatatgtttaatgtcaaatggctaaccatgaatcgtcaagtgtc |
16066719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University