View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_53 (Length: 256)
Name: NF9349_low_53
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 238
Target Start/End: Original strand, 16323840 - 16324053
Alignment:
| Q |
25 |
cttaaatactaatgctacataaatgcaattgacaaacaagaaaggaataaccttgcttaccatttctaaaaccattattataagatgatgtgaagaaaca |
124 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16323840 |
cttaaatactaatgctacatagatgcaattgacaaataagaaaggaataactttgcttaccatttctaaaaccattattataagatgatgtgaagaaaca |
16323939 |
T |
|
| Q |
125 |
atctgtagtagtgttaattccattaggacagttgcataaaaatgaattataaacttcactgtatccacaaaatccaaagctcctttcacatgcagcacaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16323940 |
atctgtagtagtgttaattccattaggacagttgcataaaaatgaattataagcttcactatatccacaaaatccaaagctcctttcacatgcagcacaa |
16324039 |
T |
|
| Q |
225 |
gagctaggataatc |
238 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16324040 |
gagctaggataatc |
16324053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University