View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_61 (Length: 250)
Name: NF9349_low_61
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_61 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 36126603 - 36126846
Alignment:
| Q |
7 |
agaagcaaaggcatgatattgtgttttcaagctcaactacaatctagaattacgaccaagaaagaaatgatgatcacataaatttggtgtcactgaagat |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36126603 |
agaagcacaggcatgatattgtgttttcaagctcaactacaatctagaattacgaccaagaaagaaatgatgatcacataaatttggagtcactgaagat |
36126702 |
T |
 |
| Q |
107 |
tgataagggaagaaaatacaaagtacacacagctgcacgcagcatgtcatccataatatttatagcccaacgccattgtccggctcgaccatgcgcatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126703 |
tgataagggaagaaaatacaaagtacacacagctgcacgcagcatgtcatccataatattcatagcccaacgccattgtccggctcgaccatgcgcatta |
36126802 |
T |
 |
| Q |
207 |
ataagagcattgtctgtctcagcatcagggttacacctacaaat |
250 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
36126803 |
ataagagcattgtatgtctcagcatcaggtttacacctacaaat |
36126846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University