View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_66 (Length: 244)
Name: NF9349_low_66
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_66 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 5033564 - 5033797
Alignment:
| Q |
16 |
gaaattatctgacacttagccatacgagtctctcatagactagttttctacaacagattttaactacataaactaaatttcacctttta-tatgcacct- |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
5033564 |
gaaattatctgacacttggccatacgagtctctcatagacaagttttctacaacagattttaactacataaactaaatttcaccttttaatatgcaattc |
5033663 |
T |
 |
| Q |
114 |
---ttttcatggcaatgacacattgatttttatgagttgcaattaaggtgtttgatgaaagacttgaggagagtgatttcatcctcaactttgcaacgaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033664 |
tatttttcatggcaatgacacattgatttttatgagttgcaattaaggtgtttgatgaaagacttgaggagagtgatttcatcctcaactttgcaacgaa |
5033763 |
T |
 |
| Q |
211 |
tgcaattaaggtatgtgatgaagtgaaaccatac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
5033764 |
tgcaattaaggtatgtgatgaagtgaaaccatac |
5033797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 59 - 104
Target Start/End: Complemental strand, 5026413 - 5026368
Alignment:
| Q |
59 |
ttttctacaacagattttaactacataaactaaatttcacctttta |
104 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
5026413 |
ttttctacaacagatgttaattacataaaataaatttcacctttta |
5026368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University