View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_68 (Length: 242)
Name: NF9349_low_68
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_68 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 6 - 162
Target Start/End: Original strand, 40562763 - 40562919
Alignment:
| Q |
6 |
tgtctcttttgcttgacattttttaatgtgtttatttagatattttcttataaaggaaatcaaataaaaatgagactaaattatagatgagagagaacgg |
105 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40562763 |
tgtctgttttgcttgacattttttaatgtgtttatttagatattttcttataaaggaaatcaaataaaaattagactaaattatagatgagagagaacgg |
40562862 |
T |
|
| Q |
106 |
gaaagcgattggtggacatgtctataataatagagtgctgtatgaaataagttacaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40562863 |
gaaagcgattggtggacatgtctataataatagagtgctgtatgaaataaattacaa |
40562919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 40562953 - 40563019
Alignment:
| Q |
157 |
ttacaatttttatggttgtgttcattcttccgtcaaaatgttcgttccatgatgttgatgttcaact |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40562953 |
ttacaatttttatggttgtgttcattcttccgtcaaaatgttcgttccatgatgttgatgttcaact |
40563019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University