View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_69 (Length: 242)
Name: NF9349_low_69
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_69 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 5234241 - 5234466
Alignment:
| Q |
18 |
cattcgatcttagagtaagactgatttaccttaataggttttggatttcacaagttcttttttatgacgaaaaatggggttatccccaaggaaatcaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5234241 |
cattcgatcttagagtaagactgatttaccttaataggttttggatttcacaagttcttttttatgacgaaaaatggggttaaccccaaggaaatcaaac |
5234340 |
T |
|
| Q |
118 |
aaagaaagctagaaaactttaacttgtgaaagcctc-ttttgttccctacttttatgaagtaagataattgctcaataggtctatcggagttgctcatca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5234341 |
aaagaaagctagaaaactttaacttgtgaaagcctctttttgttccctacttttacgaagtaagataattgctcaataggtctatcggagttgctcatca |
5234440 |
T |
|
| Q |
217 |
cattggatcgcaaatagacacttttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5234441 |
cattggatcgcaaatagacacttttt |
5234466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University