View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_73 (Length: 240)
Name: NF9349_low_73
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 51 - 232
Target Start/End: Original strand, 2150905 - 2151086
Alignment:
| Q |
51 |
ggtggtgcccacacatgaaacactttatttaacatttttatgaataactgcacgaggagtcctttactcgatcagatttttggacatagaatattgtttt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2150905 |
ggtggtgcccacacatgaaacactttatttaacatttttatgaataactgcacgaggagtcctttactcgataagatttttggacatagaatattgtttt |
2151004 |
T |
|
| Q |
151 |
aaaatcagaaatttagacttacttgtgtggctttgaatatgtagacaaaagaatttctcttcataagcaataactctctgct |
232 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151005 |
aaaatcagaaatttagactcacttgtgtggctttgaatatgtagacaaaagaatttctcttcataagcaataactctctgct |
2151086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 171 - 232
Target Start/End: Original strand, 2163303 - 2163364
Alignment:
| Q |
171 |
acttgtgtggctttgaatatgtagacaaaagaatttctcttcataagcaataactctctgct |
232 |
Q |
| |
|
||||| ||| ||||||| |||| |||||| ||||||| |||||||||||| || |||||||| |
|
|
| T |
2163303 |
acttgagtgactttgaaaatgtggacaaacgaatttcgcttcataagcaaaaattctctgct |
2163364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University