View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_74 (Length: 239)
Name: NF9349_low_74
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 6595407 - 6595311
Alignment:
| Q |
7 |
agtagcaatcaagtaatgcagctaatgaaataaactatctttcaactaccactagactaaagcaccaaatagaagttacagaaccagtaaagagaaa |
103 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6595407 |
agtagcaatcaagtaatgtagctaatgaaataaactatctttcaactatcactaaactaaagcaccaaatagaagttacagaaccagtaaagagaaa |
6595311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 100 - 170
Target Start/End: Complemental strand, 6595168 - 6595098
Alignment:
| Q |
100 |
gaaaagacataagattcatacactacaaaagatgatggttgtctagccaccgttcactaaaagggtttgaa |
170 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
6595168 |
gaaaagacatgagattcatactctacaaaagatgatggttgtctagcaaccgtttactaaaagtgtttgaa |
6595098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 223
Target Start/End: Complemental strand, 6595055 - 6595008
Alignment:
| Q |
176 |
tgaaggttaatttgaaggtcgttgagtttgtgtgggggttgtttgaat |
223 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6595055 |
tgaaggttaacttgaagggagttgagtttgtgtgggagttgtttgaat |
6595008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 82
Target Start/End: Complemental strand, 6597565 - 6597497
Alignment:
| Q |
14 |
atcaagtaatgcagctaatgaaataaactatctttcaactaccactagactaaagcaccaaatagaagt |
82 |
Q |
| |
|
||||| ||||| ||| ||| |||||||||||| | ||||| |||||||| ||| |||||||||||||| |
|
|
| T |
6597565 |
atcaaataatgtagccaatcaaataaactatccattaactaacactagacaaaaacaccaaatagaagt |
6597497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University