View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_77 (Length: 238)
Name: NF9349_low_77
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 128
Target Start/End: Complemental strand, 23552659 - 23552532
Alignment:
| Q |
1 |
cagaaagattacttcgacgaccagattgacgaaaagaatcattaacaatcggttccagatcaatgtccattggaatcggacctgattcttggttccgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
23552659 |
cagaaagattacttcgacgaccagattgacgaaaagaatcattaacaatcggttccagatcaatgtccattggaatcggacctgattcttggttcctcgt |
23552560 |
T |
 |
| Q |
101 |
agtagcttgagaaaagagagataacaaa |
128 |
Q |
| |
|
||||||||||||||||| ||| ||||| |
|
|
| T |
23552559 |
cgtagcttgagaaaagagggattacaaa |
23552532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 32060609 - 32060573
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
32060609 |
accggtgccgggattgcggccgttacaaaacggtatc |
32060573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 191 - 223
Target Start/End: Original strand, 35754030 - 35754062
Alignment:
| Q |
191 |
gtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
35754030 |
gtaccgggattgcggccgttacaaaacggtatc |
35754062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 7840089 - 7840053
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7840089 |
accggtaccgggattgcggccgttacaaaacggtatc |
7840053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 11676271 - 11676307
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11676271 |
accggtaccgggattgcggccgttacaaatcggtatc |
11676307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 29668752 - 29668788
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |
|
|
| T |
29668752 |
accggtaccgggattgtggccgttacaaaacggtatc |
29668788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 9996 - 9960
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9996 |
accggtaccgggattgcggccgttacaaaacggtatc |
9960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 12722 - 12686
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12722 |
accggtaccgggattgcggccgttacaaaacggtatc |
12686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 17757 - 17721
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17757 |
accggtaccgggattgcggccgttacaaaacggtatc |
17721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 2315974 - 2315938
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2315974 |
accggtaccgggattgcggccgttacaaaacggtatc |
2315938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 2643723 - 2643687
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2643723 |
accggtaccgggattgcggccgttacaaaacggtatc |
2643687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 11016002 - 11016038
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
11016002 |
accggtaccggaattgcggacgttacaaaacggtatc |
11016038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 28071508 - 28071472
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
28071508 |
accggtaccgggattgcggccgttacaaaacggtatc |
28071472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 50063749 - 50063785
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50063749 |
accggtaccgggattgcggccgttacaaaacggtatc |
50063785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Complemental strand, 25516880 - 25516846
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggta |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25516880 |
accggtaccgggattgcggccgttacaaaacggta |
25516846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Original strand, 25536738 - 25536772
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggta |
221 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
25536738 |
accggtaccgggattgcggccgttacaaaacggta |
25536772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 2544979 - 2545015
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2544979 |
accggtaccgggattgcggccgttacaaaacggtatc |
2545015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Complemental strand, 35127269 - 35127233
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35127269 |
accggtaccgggattgcggccgttacaaaacggtatc |
35127233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 36430005 - 36430041
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36430005 |
accggtaccgggattgcggccgttacaaaacggtatc |
36430041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 187 - 223
Target Start/End: Original strand, 46278520 - 46278556
Alignment:
| Q |
187 |
accggtaccgggattgcggtcgttacaaaacggtatc |
223 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46278520 |
accggtaccgggattgcggccgttacaaaacggtatc |
46278556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University