View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_82 (Length: 231)
Name: NF9349_low_82
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_82 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 5378901 - 5379132
Alignment:
| Q |
1 |
caagatactatttgtgtatagcaaatttggaattattggtggatttttccttctaagttgcnnnnnnnaggtactagagccaagttagtcggatccaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5378901 |
caagatactatttgtgtatagcaaatttggaattattggtggatttttccttctaagttgctttttttaggtactagagccaagttagtcggatccaaat |
5379000 |
T |
|
| Q |
101 |
cacacacacaaaactttaccttttttgaagatgtttcttttcaactgttttgacttggctttgtgatttgaaacttgaaggcaggcac-aaaaagcaaag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5379001 |
cacacacacaaaactttaccttttttgaagatgtttcttttcaactgttttgacttggctttgtgatttgaaacttgaaggcaggcacaaaaaagcaaag |
5379100 |
T |
|
| Q |
200 |
ctagtgaaatgatgaaagggtgaggtgcattt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5379101 |
ctagtgaaatgatgaaagggtgaggtgcattt |
5379132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University