View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9349_low_84 (Length: 227)

Name: NF9349_low_84
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9349_low_84
NF9349_low_84
[»] chr7 (1 HSPs)
chr7 (1-227)||(47678423-47678647)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 47678647 - 47678423
Alignment:
1 gtgaagaccataatacatagccttttttagcatttgttagtttgcaagttacagcagaggtgagtgagtccacatacacatatgtctgagtctgagacca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
47678647 gtgaagaccataatacatagccttttttagcatttgttagtttgcaagttacagcagaggtgagtgagtccacataca--tatgtctgagtctgagacca 47678550  T
101 caacagttctttgccttgccttaaatgactttgcaataatgtgcggtactatagttttttggctcacttctgtgttttaccatgtgacctggtgggggaa 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47678549 caacagttctttgccttgccttaaatgactttgcaataatgtgcggtactatagttttttggctcacttctgtgttttaccatgtgacctggtgggggaa 47678450  T
201 atgccccccaaatttttgacactttct 227  Q
    |||||||||||||||||||||||||||    
47678449 atgccccccaaatttttgacactttct 47678423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University