View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_87 (Length: 226)
Name: NF9349_low_87
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_87 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 210
Target Start/End: Complemental strand, 39015165 - 39014965
Alignment:
| Q |
10 |
agcagagaagagaacaacaacaacaataatagttccaaacttaacacacaacaattcatgtatgagacaacacctccatccctaactttgatgtcatcat |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39015165 |
agcaaagaagagaacaacaacaacaataatagttccaaactcaacacacaacaattcatgtatgagacaacacctccatccctaactttgatgtcatcat |
39015066 |
T |
 |
| Q |
110 |
ctccaacaaattaccaaaccatccctagtggctataacaaacttgattctttttcttcccccatgacaacacttcatcatttaaatccaaaccaaaacaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39015065 |
ctccaacaaattaccaaaccatccctagtggctataacaaacttgattctttttcttcccccatgacaacacttcatcatttaaatccaaaccaaaacaa |
39014966 |
T |
 |
| Q |
210 |
t |
210 |
Q |
| |
|
| |
|
|
| T |
39014965 |
t |
39014965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University