View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_88 (Length: 224)
Name: NF9349_low_88
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 21127030 - 21126842
Alignment:
| Q |
18 |
agagcgagaatttgagaataggaatattattttcaccctccaaatatcatacaaaaagtaaattacataatgttgggatcacatatgttagaggatgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21127030 |
agagcgagaatttgagaataggaatattattttcaccctccaaatatcatacaaaaagtaaattacataatgttgggatcacatatgttagaggatgttt |
21126931 |
T |
|
| Q |
118 |
tgattttcatcttaatatgattgaaacaattgaaag-aaaatttaaatgcttgtcccgttaaaggttcccatgcatccagtttgccaac |
205 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21126930 |
tgattttcatcttgatatgattgaaacaattgaaagaaaaatttaaatgcttgtcccgttaaaggttcccatgcatccagtttgccaac |
21126842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University