View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_90 (Length: 223)
Name: NF9349_low_90
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_90 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 205
Target Start/End: Original strand, 47077809 - 47077998
Alignment:
| Q |
12 |
attatactaatagttctgtttttgtattaattaagagttaagactggctgtgcatttctaagtgtttatttagtatttaccactaatgtgtgcccttttt |
111 |
Q |
| |
|
|||||| |||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077809 |
attatattaatagttgtgtttttgtatta----agagttaagactggctgtgcatttctaagtgtttatttagtatttaccactaatgtgtgcccttttt |
47077904 |
T |
|
| Q |
112 |
atgttctaaacgtagcggatcgtacacgtctcctgccttagcgagtttttcttttcatgttccctcatatgtggatcctcatggggatccatat |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47077905 |
atgttctaaaagtagcggatcgtacacgtctcctgccttagcgagtttttcttttcatgttccctcatatgtggatcctcatggggatccatat |
47077998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University