View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9349_low_96 (Length: 218)
Name: NF9349_low_96
Description: NF9349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9349_low_96 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 23 - 201
Target Start/End: Complemental strand, 22104100 - 22103922
Alignment:
| Q |
23 |
tactgatcctccctcgatttgataacaccctccctcgtacacgaaaacggacgatcacgacagtgtgtcaatgaccgtccacgtccatactcatgcaaaa |
122 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| | |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22104100 |
tactgatcctccctcgattcgataacaccctccctcgtacccaaaaacggacgatcacgacggtgtgtcaatgaccatccacgtccatactcatgcaaaa |
22104001 |
T |
|
| Q |
123 |
ccctatccctgggcaattgatcaacacgcaaattgaccctactgcgaggcctgctgtcaaacctgtcgatgccatacct |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22104000 |
ccctaaccctgggcaattgatcaacacgcaaactgaccctactgcgaggcctgctgtcaaacctgtcggtgccatacct |
22103922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University