View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9350_low_19 (Length: 219)
Name: NF9350_low_19
Description: NF9350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9350_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 50245360 - 50245170
Alignment:
| Q |
15 |
cacagattaactaattatattcaagcctcggaaaggnnnnnnnnnctctctttcaagtttcaaaaacacaatccgtaaacaattaaatcaataaatataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50245360 |
cacagattaactaattatattcaagcctcggaaaggaaaaaaaaactctctttcaagtttcaaaaacacaatccgtaaacaattaaatcaataaatataa |
50245261 |
T |
 |
| Q |
115 |
ttatatctcacnnnnnnnnaagaataatcatg--tcacttgatcttttaatatgactgattgatataatggtagaaacaaattcatatatg |
203 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50245260 |
ttatatctcacttttttttaagaataatcatgtctcacttgatcttttaatatgactgattgatataatggtagaaacaaattcatatatg |
50245170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University