View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_high_10 (Length: 230)
Name: NF9351_high_10
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_high_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 8812835 - 8812660
Alignment:
| Q |
23 |
tgggtctattcatgattatcccggggatgatcaagctacatcacactagatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtct |
122 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8812835 |
tgggtctat-catgattatcccggggttgatcaagctacatcacactagatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtct |
8812737 |
T |
|
| Q |
123 |
tttggtacagcgattcattaagtttgttcaggcccgtgcttcagttttgctgtgtctgattaagcatattgtagggg |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
8812736 |
tttgggacagcgattcattaagtttgttcaggcctgtgcttcagttttgttgtgtttgattaagcatattttagggg |
8812660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 70 - 160
Target Start/End: Original strand, 4773844 - 4773934
Alignment:
| Q |
70 |
agatgatttagttacagtaggttttagttttagatgcaataatgcaaaggtcttttggtacagcgattcattaagtttgttcaggcccgtg |
160 |
Q |
| |
|
||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||| || ||| |||||||| |||| ||||||||| |
|
|
| T |
4773844 |
agatgatttagatgaagtaggttttagttttatatgcaataatgcaaaggtcttttggtatagtgatccattaagtctgtttaggcccgtg |
4773934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University