View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9351_low_16 (Length: 275)

Name: NF9351_low_16
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9351_low_16
NF9351_low_16
[»] chr3 (1 HSPs)
chr3 (9-216)||(32680137-32680350)


Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 216
Target Start/End: Original strand, 32680137 - 32680350
Alignment:
9 ggttagataatcaatataacccccttatgtaggattcaaacttaagaggatccaaatccgattaacacgaattatcatgaagccttgagttaatttaatt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
32680137 ggttagataatcaatataacccccttatgtaggattcaaacttaagaggatccaaatccgattaacaagaattatcatgaagccttgagttaatttaatt 32680236  T
109 taatcatcaatcaccccttattcttgaag------cagaaccagaaccattgtctctttggggatgaactctccgatacctgccatggaaaggccaaaga 202  Q
    |||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32680237 taatcatcaatcaccccttattcttgaagcagaaccagaaccagaaccattgtctctttggggatgaactctccgatacctgccatggaaaggccaaaga 32680336  T
203 gacgaaattcttgt 216  Q
    ||||||||||||||    
32680337 gacgaaattcttgt 32680350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University