View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_16 (Length: 275)
Name: NF9351_low_16
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 216
Target Start/End: Original strand, 32680137 - 32680350
Alignment:
| Q |
9 |
ggttagataatcaatataacccccttatgtaggattcaaacttaagaggatccaaatccgattaacacgaattatcatgaagccttgagttaatttaatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32680137 |
ggttagataatcaatataacccccttatgtaggattcaaacttaagaggatccaaatccgattaacaagaattatcatgaagccttgagttaatttaatt |
32680236 |
T |
 |
| Q |
109 |
taatcatcaatcaccccttattcttgaag------cagaaccagaaccattgtctctttggggatgaactctccgatacctgccatggaaaggccaaaga |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32680237 |
taatcatcaatcaccccttattcttgaagcagaaccagaaccagaaccattgtctctttggggatgaactctccgatacctgccatggaaaggccaaaga |
32680336 |
T |
 |
| Q |
203 |
gacgaaattcttgt |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32680337 |
gacgaaattcttgt |
32680350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University