View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_18 (Length: 274)
Name: NF9351_low_18
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 263
Target Start/End: Complemental strand, 43491109 - 43490877
Alignment:
| Q |
16 |
caatgatctcagctttgactcatatcgtttctggagatgttccaacccaaagtgacgctgatatagttcatcataatagtgcaagtgaaggaagggttgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43491109 |
caatgatctcagctttgactcatatcgtttctggagatgttccaacccaaagtgacgctgatatagttcatcataatagtgcaattgaaggaagggttgc |
43491010 |
T |
|
| Q |
116 |
ttttgcaacaaatatcaataataatatgtcttctccttctacaatacaatctttgtcttctccttcttcttcatctaattatgctactagttcttctctc |
215 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43491009 |
ttttgcaacaaatatcaataacaatatgtcttctccttctacaacacaatctttgtcttctccttcttcttcat---------------gttcttctctc |
43490925 |
T |
|
| Q |
216 |
aagagaactagggaagatgatagatttgttggtgatttcaaattcctc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43490924 |
aagagaactagggaagatgatagatttgttggtgatttcaaattcctc |
43490877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University