View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_22 (Length: 248)
Name: NF9351_low_22
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 11 - 163
Target Start/End: Original strand, 10941830 - 10941984
Alignment:
| Q |
11 |
tgttcggaaaatacttaagaaagccactttaaaatatctcaaactcaatcttgcaaatattccattatttccacttttgaaggtaaatg----tgtggtg |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10941830 |
tgttcggaaaatacttaagaaagccactttaaaat--ctcaaactcaatcttgcaaatattccattatttccacttttgaaggtaaatgcgtgtgtggtg |
10941927 |
T |
 |
| Q |
107 |
gaactctcaatcacaaagtaaagttgacacatagtggaaattgttttgttaggaata |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10941928 |
gaactctcaatcacaaagtaaagttgacacatagtggaaattgttttgttaggaata |
10941984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 204 - 233
Target Start/End: Original strand, 10942475 - 10942504
Alignment:
| Q |
204 |
ttagagttcttctgctcgaaggaaaagctg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10942475 |
ttagagttcttctgctcgaaggaaaagctg |
10942504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University