View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_25 (Length: 245)
Name: NF9351_low_25
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 26882019 - 26881806
Alignment:
| Q |
19 |
atctttagggattgtggtcggtgaccctttaccaaaatcatctttgtagttctaatatcaaacaaatcaacaattcgtgtagccatctctgttgtggtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26882019 |
atctttagggattgtggtcggtgaccctttaccaaaatcatctttgtagttctaatatcaaacaaatcaacaattcgtgtagccatctctgttgtggtat |
26881920 |
T |
 |
| Q |
119 |
ttttaccgaaaatgaatcaaccacttattaaaaattgattannnnnnnnnaagggaaaaattagttaacttgacgcttcctcacaagcgataatataatt |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26881919 |
ttttactgaaaatgaatcaaccacttattaaaaattgattatttttttttaagggaaaaattagttaacttgacgcttcctcacaagcgataatataatt |
26881820 |
T |
 |
| Q |
219 |
ttcaacaagaataa |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26881819 |
ttcaacaagaataa |
26881806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University