View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_27 (Length: 234)
Name: NF9351_low_27
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 32231717 - 32231929
Alignment:
| Q |
13 |
tctttttcattgatggtgctggtgcgaatgagatggtcttttcaggcnnnnnnncttctctaatagaggatgttgttggcaccgtgtttccttgttcatc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32231717 |
tctttttcattgatggtgctggtgcgaatgagatggtcttttcaggctttttttcttctctaatagaggatgttgttggcaccgtgtttccttgttcatc |
32231816 |
T |
 |
| Q |
113 |
tgtgattttaaatgagcctacaagtgatgcagattgagttcatcattattgtatttttgttaattttctcattatgctgcgaataaacaataaataatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32231817 |
tgtgattttaaatgagcctacaagtgatgcagattgagttcatcattattgtatttttgttaattttctcattatgctgcgaataaacgataaataatgt |
32231916 |
T |
 |
| Q |
213 |
aacaaattgtgct |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32231917 |
aacaaattgtgct |
32231929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University