View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9351_low_28 (Length: 234)
Name: NF9351_low_28
Description: NF9351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9351_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 8730378 - 8730515
Alignment:
| Q |
8 |
tttggtgttggtgggaaagaaagaactttgagaagttcaagaggttttgcttttcttattggaaatgattttactatgaattggccaccaaatcttatac |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8730378 |
tttgttgttggtgggaaagaaagaactttgagaagttcaagaggttttgcttttcttattggaaatgattttactatgaattggccaccaaatcttatac |
8730477 |
T |
 |
| Q |
108 |
ccttaacttctgaggttggtttgaaggagaaatctgag |
145 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
8730478 |
cttttacttctgaggttggtttgaaggagaaatctgag |
8730515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University